Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ADRB2 cDNA Clone in Mammalian Expression Vector

This is a Adrenergic, beta-2-, Receptor, Surface plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2050 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382386
Supplier Product No.: sc116997
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ADRB2 cDNA Clone in Mammalian Expression Vector (ABIN3382386)

Gene

beta 2 Adrenergic Receptor (ADRB2) (Adrenergic, beta-2-, Receptor, Surface (ADRB2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116997

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ADRB2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2050 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shinoda, Shinya, Ito, Ishizuka-Katsura, Ohsawa, Terada, Hirata, Kawano, Yamamoto, Tomita, Ishibashi, Hirabayashi, Kimura-Someya, Shirouzu, Yokoyama: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, pp. 30442, (2016) (PubMed).

    Ferrie, Sun, Zaytseva, Fang: "Divergent label-free cell phenotypic pharmacology of ligands at the overexpressed β₂-adrenergic receptors." in: Scientific reports, Vol. 4, pp. 3828, (2014) (PubMed).

    Moriyama, Sitkovsky: "Adenosine A2A receptor is involved in cell surface expression of A2B receptor." in: The Journal of biological chemistry, Vol. 285, Issue 50, pp. 39271-88, (2010) (PubMed).

    Shi, Wu, Cui, Shi, Yang, Zhang, Rojas, Ha, Jiang: "PKA phosphorylation of SUR2B subunit underscores vascular KATP channel activation by beta-adrenergic receptors." in: American journal of physiology. Regulatory, integrative and comparative physiology, Vol. 293, Issue 3, pp. R1205-14, (2007) (PubMed).

  • Target

    beta 2 Adrenergic Receptor (ADRB2) (Adrenergic, beta-2-, Receptor, Surface (ADRB2))

    Alternative Name

    ADRB2

    Background

    This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_000024, NP_000015
You are here: