Human ANXA7 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ANXA7 cDNA Clone in Mammalian Expression Vector (ABIN3382509)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc126802
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ANXA7 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2320 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Targeting annexin A7 by a small molecule suppressed the activity of phosphatidylcholine-specific phospholipase C in vascular endothelial cells and inhibited atherosclerosis in apolipoprotein E⁻/⁻mice." in: Cell death & disease, Vol. 4, pp. e806, (2013) (PubMed).
-
: "Targeting annexin A7 by a small molecule suppressed the activity of phosphatidylcholine-specific phospholipase C in vascular endothelial cells and inhibited atherosclerosis in apolipoprotein E⁻/⁻mice." in: Cell death & disease, Vol. 4, pp. e806, (2013) (PubMed).
-
- Annexin VII (ANXA7) (Annexin A7 (ANXA7))
-
Alternative Name
- ANXA7
-
Background
- Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) lacks an alternate in-frame exon, compared to variant 2, resulting in a shorter protein (isoform 1) that lacks an internal segment, compared to isoform 2.
-
NCBI Accession
- NM_001156, NP_001147
Target
-