Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human APEX1 cDNA Clone in Mammalian Expression Vector

This is a Apurinic/Apyrimidinic Endonuclease 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1540 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382531
Supplier Product No.: sc119121
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human APEX1 cDNA Clone in Mammalian Expression Vector (ABIN3382531)

Gene

APEX1 (Apurinic/Apyrimidinic Endonuclease 1 (APEX1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119121

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human APEX1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1540 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kim, Ma, Li, Chohan, Wilson, Lee: "Altered endoribonuclease activity of apurinic/apyrimidinic endonuclease 1 variants identified in the human population." in: PLoS ONE, Vol. 9, Issue 3, pp. e90837, (2014) (PubMed).

    Wang, Wang, Chen, Zhang, Tang, Park, Cucinotta, Yu, Deng, Dynan, Doetsch, Wang: "Distinct roles of Ape1 protein, an enzyme involved in DNA repair, in high or low linear energy transfer ionizing radiation-induced cell killing." in: The Journal of biological chemistry, Vol. 289, Issue 44, pp. 30635-44, (2014) (PubMed).

    McManus, Sands, Diver, MacKenzie, Fraser, Davies, Connell: "APEX1 regulation of aldosterone synthase gene transcription is disrupted by a common polymorphism in humans." in: Circulation research, Vol. 111, Issue 2, pp. 212-9, (2012) (PubMed).

  • Target

    APEX1 (Apurinic/Apyrimidinic Endonuclease 1 (APEX1))

    Alternative Name

    APEX1

    Background

    Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes the major AP endonuclease in human cells. Splice variants have been found for this gene, all encode the same protein. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) contains the full-length first exon and is the longest transcript.

    NCBI Accession

    NM_001641, NP_001632
You are here: