Human ARRB2 cDNA Clone in Mammalian Expression Vector
This is a Arrestin, beta 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1880 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3382609
Supplier Product No.: sc108950
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human ARRB2 cDNA Clone in Mammalian Expression Vector (ABIN3382609)
Gene
Arrestin 3 (ARRB2)
(Arrestin, beta 2 (ARRB2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc108950
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ARRB2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1880 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cross talk between phosphatidylinositol 3-kinase and cyclic AMP (cAMP)-protein kinase a signaling pathways at the level of a protein kinase B/beta-arrestin/cAMP phosphodiesterase 4 complex." in: Molecular and cellular biology, Vol. 30, Issue 7, pp. 1660-72, (2010) (PubMed).
: "Site-specific cleavage of G protein-coupled receptor-engaged beta-arrestin. Influence of the AT1 receptor conformation on scissile site selection." in: The Journal of biological chemistry, Vol. 283, Issue 31, pp. 21612-20, (2008) (PubMed).
-
: "Cross talk between phosphatidylinositol 3-kinase and cyclic AMP (cAMP)-protein kinase a signaling pathways at the level of a protein kinase B/beta-arrestin/cAMP phosphodiesterase 4 complex." in: Molecular and cellular biology, Vol. 30, Issue 7, pp. 1660-72, (2010) (PubMed).
-
- Arrestin 3 (ARRB2) (Arrestin, beta 2 (ARRB2))
-
Alternative Name
- ARRB2
-
Background
- Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012].Transcript Variant: This variant (1) uses an alternate in-frame splice junction at the 3' end of an exon compared to variant 3. The resulting isoform (1) lacks an alternate internal segment compared to isoform 3.
-
NCBI Accession
- NM_004313, NP_004304
Target
-
You are here:
