Human ASPH cDNA Clone in Mammalian Expression Vector
This is a Aspartate beta-Hydroxylase plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2740 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3382634
Supplier Product No.: sc108956
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 21 to 22 Business Days
Quick Overview for Human ASPH cDNA Clone in Mammalian Expression Vector (ABIN3382634)
Gene
Aspartate beta Hydroxylase (ASPH)
(Aspartate beta-Hydroxylase (ASPH))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc108956
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ASPH is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2740 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- Aspartate beta Hydroxylase (ASPH) (Aspartate beta-Hydroxylase (ASPH))
-
Alternative Name
- ASPH
-
Background
- This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009].Transcript Variant: This variant (4) represents use of an alternate promoter and 5' UTR, uses a distinct start codon, and uses a distinct 3' splice pattern that lacks many coding exons, compared to variant 1. The encoded isoform (d) has a slightly shorter and distinct N-terminus and some overlap with the N-terminus of isoform a, but lacks the catalytic domain and enzymatic function of isoform a. This isoform has also been referred to as junctin and forms a complex with calsequestrin, triadin, and the ryanodine receptor by direct interaction at the C-terminal part of the molecule. This protein appears to stabilize the complex and plays a crucial role in the regulation of calcium release from the sarcoplasmic reticulum. This variant is expressed in cardiac and skeletal muscle.
-
NCBI Accession
- NM_032467, NP_115856
Target
-
You are here:
