Human ATF4 cDNA Clone in Mammalian Expression Vector
This is a Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1200 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3382640
Supplier Product No.: sc119103
$679.14
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ATF4 cDNA Clone in Mammalian Expression Vector (ABIN3382640)
Gene
ATF4
(Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67) (ATF4))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119103
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ATF4 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, (2013) (PubMed).
: "Regulation of endoplasmic reticulum stress-induced cell death by ATF4 in neuroectodermal tumor cells." in: The Journal of biological chemistry, Vol. 285, Issue 9, pp. 6091-100, (2010) (PubMed).
-
: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, (2013) (PubMed).
-
- ATF4 (Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67) (ATF4))
-
Alternative Name
- ATF4
-
Background
- This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (1) represents the longer transcript. The protein translation of this variant is regulated by an internal ribosome entry site (PMID: 23665047). Both variants 1 and 2 encode the same protein.
-
NCBI Accession
- NM_001675, NP_001666
Target
-
You are here:
