Human ATF4 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ATF4 cDNA Clone in Mammalian Expression Vector (ABIN3382640)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119103
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ATF4 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1200 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, (2013) (PubMed).
: "Regulation of endoplasmic reticulum stress-induced cell death by ATF4 in neuroectodermal tumor cells." in: The Journal of biological chemistry, Vol. 285, Issue 9, pp. 6091-100, (2010) (PubMed).
-
: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, (2013) (PubMed).
-
- ATF4 (Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67) (ATF4))
-
Alternative Name
- ATF4
-
Background
- This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011].Transcript Variant: This variant (1) represents the longer transcript. The protein translation of this variant is regulated by an internal ribosome entry site (PMID: 23665047). Both variants 1 and 2 encode the same protein.
-
NCBI Accession
- NM_001675, NP_001666
Target
-