Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ATP1A1 cDNA Clone in Mammalian Expression Vector

This is a Sodium Potassium ATPase, alpha1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4040 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382650
Supplier Product No.: sc119714
$980.10
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ATP1A1 cDNA Clone in Mammalian Expression Vector (ABIN3382650)

Gene

ATP1A1 (Sodium Potassium ATPase, alpha1 (ATP1A1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119714

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ATP1A1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4040 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Azizan, Poulsen, Tuluc, Zhou, Clausen, Lieb, Maniero, Garg, Bochukova, Zhao, Shaikh, Brighton, Teo, Davenport, Dekkers, Tops, Küsters, Ceral, Yeo, Neogi, McFarlane, Rosenfeld, Marass, Hadfield et al.: "Somatic mutations in ATP1A1 and CACNA1D underlie a common subtype of adrenal hypertension. ..." in: Nature genetics, Vol. 45, Issue 9, pp. 1055-60, (2013) (PubMed).

    Hazelwood, Free, Cabrera, Skinbjerg, Sibley: "Reciprocal modulation of function between the D1 and D2 dopamine receptors and the Na+,K+-ATPase." in: The Journal of biological chemistry, Vol. 283, Issue 52, pp. 36441-53, (2008) (PubMed).

    Morth, Poulsen, Toustrup-Jensen, Schack, Egebjerg, Andersen, Vilsen, Nissen: "The structure of the Na+,K+-ATPase and mapping of isoform differences and disease-related mutations." in: Philosophical transactions of the Royal Society of London. Series B, Biological sciences, Vol. 364, Issue 1514, pp. 217-27, (2008) (PubMed).

  • Target

    ATP1A1 (Sodium Potassium ATPase, alpha1 (ATP1A1))

    Alternative Name

    ATP1A1

    Background

    The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009].Transcript Variant: This variant (1) represents use of an alternate promoter and 5' exon, compared to variant 3. The resulting isoform (a) is the same length but has a distinct N-terminus, compared to isoform c.

    NCBI Accession

    NM_000701, NP_000692
You are here: