Human ATP5G2 cDNA Clone in Mammalian Expression Vector
This is a ATP Synthase, H+ Transporting, Mitochondrial Fo Complex, Subunit C2 (Subunit 9) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 650 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3382657
Supplier Product No.: sc116891
$148.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ATP5G2 cDNA Clone in Mammalian Expression Vector (ABIN3382657)
Gene
ATP5G2
(ATP Synthase, H+ Transporting, Mitochondrial Fo Complex, Subunit C2 (Subunit 9) (ATP5G2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc116891
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ATP5G2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 650 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- ATP5G2 (ATP Synthase, H+ Transporting, Mitochondrial Fo Complex, Subunit C2 (Subunit 9) (ATP5G2))
-
Alternative Name
- ATP5G2
-
Background
- This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene has multiple pseudogenes. [provided by RefSeq, Jun 2010].Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (b) uses the same start codon but has an additional segment in the N-terminus, when compared to isoform a, which results in a longer protein.
-
NCBI Accession
- NM_005176, NP_005167
Target
-
You are here:
