Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BACE1 cDNA Clone in Mammalian Expression Vector

This is a Beta-secretase 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3270 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382704
Supplier Product No.: sc115547
$462.33
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human BACE1 cDNA Clone in Mammalian Expression Vector (ABIN3382704)

Gene

BACE1 (Beta-secretase 1 (BACE1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115547

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BACE1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3270 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Fisher, Resnick, De, Acevedo, Lu, Schroeder, Nicholson: "Cyclic cis-Locked Phospho-Dipeptides Reduce Entry of AβPP into Amyloidogenic Processing Pathway." in: Journal of Alzheimer's disease : JAD, Vol. 55, Issue 1, pp. 391-410, (2016) (PubMed).

    Atkin, Hunt, Minakawa, Sharkey, Tipper, Tennant, Paulson: "F-box only protein 2 (Fbxo2) regulates amyloid precursor protein levels and processing." in: The Journal of biological chemistry, Vol. 289, Issue 10, pp. 7038-48, (2014) (PubMed).

    Wang, Wilfred, Madathil, Tang, Hu, Dimayuga, Stromberg, Huang, Saatman, Nelson: "miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease." in: The American journal of pathology, Vol. 177, Issue 1, pp. 334-45, (2010) (PubMed).

    Minopoli, Passaro, Aloia, Carlomagno, Melillo, Santoro, Forzati, Zambrano, Russo: "Receptor- and non-receptor tyrosine kinases induce processing of the amyloid precursor protein: role of the low-density lipoprotein receptor-related protein." in: Neuro-degenerative diseases, Vol. 4, Issue 2-3, pp. 94-100, (2007) (PubMed).

  • Target

    BACE1 (Beta-secretase 1 (BACE1))

    Alternative Name

    BACE1

    Background

    This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. [provided by RefSeq, Nov 2015].Transcript Variant: This variant (a) is the longest transcript and it encodes the longest isoform (A).

    NCBI Accession

    NM_012104, NP_036236
You are here: