Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BECN1 cDNA Clone in Mammalian Expression Vector

This is a Beclin 1, Autophagy Related plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2240 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382752
Supplier Product No.: sc117750
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human BECN1 cDNA Clone in Mammalian Expression Vector (ABIN3382752)

Gene

Beclin 1 (BECN1) (Beclin 1, Autophagy Related (BECN1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc117750

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BECN1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2240 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Milewski, Gawliński, Bąk, Matysiak, Bal: "Complex interplay between the length and composition of the huntingtin-derived peptides modulates the intracellular behavior of the N-terminal fragments of mutant huntingtin." in: European journal of cell biology, Vol. 94, Issue 5, pp. 179-89, (2015) (PubMed).

    Wen, Zand, Ozpolat, Szczepanski, Lu, Yuca, Carroll, Alpay, Bartholomeusz, Tekedereli, Kang, Rupaimoole, Pecot, Dalton, Hernandez, Lokshin, Lutgendorf, Liu, Hittelman, Chen, Lopez-Berestein, Szajnik et al.: "Antagonism of tumoral prolactin receptor promotes autophagy-related cell death. ..." in: Cell reports, Vol. 7, Issue 2, pp. 488-500, (2014) (PubMed).

    Huang, Yang, Yu, Sinicrope: "Inhibition of mTOR kinase by AZD8055 can antagonize chemotherapy-induced cell death through autophagy induction and down-regulation of p62/sequestosome 1." in: The Journal of biological chemistry, Vol. 286, Issue 46, pp. 40002-12, (2011) (PubMed).

    Lian, Wu, He, Karnak, Tang, Meng, Xiang, Ji, Lawrence, Xu: "A natural BH3 mimetic induces autophagy in apoptosis-resistant prostate cancer via modulating Bcl-2-Beclin1 interaction at endoplasmic reticulum." in: Cell death and differentiation, Vol. 18, Issue 1, pp. 60-71, (2010) (PubMed).

  • Target

    Beclin 1 (BECN1) (Beclin 1, Autophagy Related (BECN1))

    Alternative Name

    BECN1

    Background

    This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].

    NCBI Accession

    NM_003766, NP_003757
You are here: