Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CALM2 cDNA Clone in Mammalian Expression Vector

This is a Calmodulin 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1160 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3382992
Supplier Product No.: sc119076
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CALM2 cDNA Clone in Mammalian Expression Vector (ABIN3382992)

Gene

Calmodulin 2 (CALM2)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119076

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CALM2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1160 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    Calmodulin 2 (CALM2)

    Alternative Name

    CALM2

    Background

    This gene is a member of the calmodulin gene family. There are three distinct calmodulin genes dispersed throughout the genome that encode the identical protein, but differ at the nucleotide level. Calmodulin is a calcium binding protein that plays a role in signaling pathways, cell cycle progression and proliferation. Several infants with severe forms of long-QT syndrome (LQTS) who displayed life-threatening ventricular arrhythmias together with delayed neurodevelopment and epilepsy were found to have mutations in either this gene or another member of the calmodulin gene family (PMID:23388215). Mutations in this gene have also been identified in patients with less severe forms of LQTS (PMID:24917665), while mutations in another calmodulin gene family member have been associated with catecholaminergic polymorphic ventricular tachycardia (CPVT)(PMID:23040497), a rare disorder thought to be the cause of a significant fraction of sudden cardiac deaths in young individuals. Pseudogenes of this gene are found on chromosomes 10, 13, and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015].Transcript Variant: This variant (2) lacks an exon in the 5' coding region, and uses an alternate start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1, and is the same protein encoded by other calmodulin gene family members.

    NCBI Accession

    NM_001743, NP_001734
You are here: