Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CASP8 cDNA Clone in Mammalian Expression Vector

This is a Caspase 8 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2700 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383037
Supplier Product No.: sc124569
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CASP8 cDNA Clone in Mammalian Expression Vector (ABIN3383037)

Gene

Caspase 8 (CASP8)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc124569

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CASP8 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2700 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    Caspase 8 (CASP8)

    Alternative Name

    CASP8

    Background

    This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (C) includes a different segment in the 5' UTR and lacks an alternate in-frame segment in the coding region, compared to variant G. Variants C and F both encode isoform C, which is shorter than isoform G. Isoform C has also been labelled as Alpha-2 or MCH5-beta.

    NCBI Accession

    NM_033356, NP_203520
You are here: