Human CAV1 cDNA Clone in Mammalian Expression Vector
This is a Caveolin 1, Caveolae Protein, 22kDa plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2400 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3383043
Supplier Product No.: sc119082
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CAV1 cDNA Clone in Mammalian Expression Vector (ABIN3383043)
Gene
Caveolin-1 (CAV1)
(Caveolin 1, Caveolae Protein, 22kDa (CAV1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119082
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CAV1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2400 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Caveolin-1 enhances rapid mucosal restitution by activating TRPC1-mediated Ca2+ signaling." in: Physiological reports, Vol. 2, Issue 11, (2014) (PubMed).
: "CpG island shore methylation regulates caveolin-1 expression in breast cancer." in: Oncogene, Vol. 32, Issue 38, pp. 4519-28, (2013) (PubMed).
: "Rift Valley fever virus strain MP-12 enters mammalian host cells via caveola-mediated endocytosis." in: Journal of virology, Vol. 86, Issue 23, pp. 12954-70, (2012) (PubMed).
: "Caveolin-1 modulates HIV-1 envelope-induced bystander apoptosis through gp41." in: Journal of virology, Vol. 84, Issue 13, pp. 6515-26, (2010) (PubMed).
: "HIV infection upregulates caveolin 1 expression to restrict virus production." in: Journal of virology, Vol. 84, Issue 18, pp. 9487-96, (2010) (PubMed).
: "Constitutive recycling of the store-operated Ca2+ channel Orai1 and its internalization during meiosis." in: The Journal of cell biology, Vol. 191, Issue 3, pp. 523-35, (2010) (PubMed).
-
: "Caveolin-1 enhances rapid mucosal restitution by activating TRPC1-mediated Ca2+ signaling." in: Physiological reports, Vol. 2, Issue 11, (2014) (PubMed).
-
- Caveolin-1 (CAV1) (Caveolin 1, Caveolae Protein, 22kDa (CAV1))
-
Alternative Name
- CAV1
-
Background
- The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010].Transcript Variant: This variant (1) encodes the longer isoform (alpha).
-
NCBI Accession
- NM_001753, NP_001744
Target
-
You are here:
