Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CD8A cDNA Clone in Mammalian Expression Vector

This is a CD8a Molecule plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2210 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383167
Supplier Product No.: sc111602
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CD8A cDNA Clone in Mammalian Expression Vector (ABIN3383167)

Gene

CD8 alpha (CD8A) (CD8a Molecule (CD8A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111602

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CD8A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2210 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kobayashi, Kishi, Ozawa, Hamana, Nakagawa, Jin, Lin, Muraguchi: "A chimeric antigen receptor for TRAIL-receptor 1 induces apoptosis in various types of tumor cells." in: Biochemical and biophysical research communications, Vol. 453, Issue 4, pp. 798-803, (2015) (PubMed).

    Kobayashi, Kishi, Ozawa, Horii, Hamana, Nagai, Muraguchi: "Retroviral vectors for homologous recombination provide efficient cloning and expression in mammalian cells." in: Biochemical and biophysical research communications, Vol. 444, Issue 3, pp. 319-24, (2014) (PubMed).

    Chancey, Shockett, OReilly: "Relative resistance to slow inactivation of human cardiac Na+ channel hNav1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6." in: American journal of physiology. Cell physiology, Vol. 293, Issue 6, pp. C1895-905, (2007) (PubMed).

  • Target

    CD8 alpha (CD8A) (CD8a Molecule (CD8A))

    Alternative Name

    CD8A

    Background

    The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011].Transcript Variant: This variant (1) encodes the longer, membrane associated isoform (1). Both variants 1 and 3 encode the same isoform (1).

    NCBI Accession

    NM_001768, NP_001759
You are here: