Human CD8A cDNA Clone in Mammalian Expression Vector
This is a CD8a Molecule plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2210 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3383167
Supplier Product No.: sc111602
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CD8A cDNA Clone in Mammalian Expression Vector (ABIN3383167)
Gene
CD8 alpha (CD8A)
(CD8a Molecule (CD8A))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc111602
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CD8A is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2210 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "A chimeric antigen receptor for TRAIL-receptor 1 induces apoptosis in various types of tumor cells." in: Biochemical and biophysical research communications, Vol. 453, Issue 4, pp. 798-803, (2015) (PubMed).
: "Retroviral vectors for homologous recombination provide efficient cloning and expression in mammalian cells." in: Biochemical and biophysical research communications, Vol. 444, Issue 3, pp. 319-24, (2014) (PubMed).
: "Relative resistance to slow inactivation of human cardiac Na+ channel hNav1.5 is reversed by lysine or glutamine substitution at V930 in D2-S6." in: American journal of physiology. Cell physiology, Vol. 293, Issue 6, pp. C1895-905, (2007) (PubMed).
-
-
- CD8 alpha (CD8A) (CD8a Molecule (CD8A))
-
Alternative Name
- CD8A
-
Background
- The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011].Transcript Variant: This variant (1) encodes the longer, membrane associated isoform (1). Both variants 1 and 3 encode the same isoform (1).
-
NCBI Accession
- NM_001768, NP_001759
Target
-
You are here:
