Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CDK9 cDNA Clone in Mammalian Expression Vector

This is a Cyclin-Dependent Kinase 9 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1910 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383219
Supplier Product No.: sc119344
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CDK9 cDNA Clone in Mammalian Expression Vector (ABIN3383219)

Gene

CDK9 (Cyclin-Dependent Kinase 9 (CDK9))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119344

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CDK9 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1910 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Sayed, Yang, He, Pfleger, Abdellatif: "Acute targeting of general transcription factor IIB restricts cardiac hypertrophy via selective inhibition of gene transcription." in: Circulation. Heart failure, Vol. 8, Issue 1, pp. 138-48, (2015) (PubMed).

    Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, (2015) (PubMed).

    Ma, Chen, Wright, Pillai, Chellappan, Cress: "CDKN1C negatively regulates RNA polymerase II C-terminal domain phosphorylation in an E2F1-dependent manner." in: The Journal of biological chemistry, Vol. 285, Issue 13, pp. 9813-22, (2010) (PubMed).

  • Target

    CDK9 (Cyclin-Dependent Kinase 9 (CDK9))

    Alternative Name

    CDK9

    Background

    The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_001261, NP_001252
You are here: