Human CDK9 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human CDK9 cDNA Clone in Mammalian Expression Vector (ABIN3383219)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc119344
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CDK9 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1910 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Acute targeting of general transcription factor IIB restricts cardiac hypertrophy via selective inhibition of gene transcription." in: Circulation. Heart failure, Vol. 8, Issue 1, pp. 138-48, (2015) (PubMed).
: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, (2015) (PubMed).
: "CDKN1C negatively regulates RNA polymerase II C-terminal domain phosphorylation in an E2F1-dependent manner." in: The Journal of biological chemistry, Vol. 285, Issue 13, pp. 9813-22, (2010) (PubMed).
-
: "Acute targeting of general transcription factor IIB restricts cardiac hypertrophy via selective inhibition of gene transcription." in: Circulation. Heart failure, Vol. 8, Issue 1, pp. 138-48, (2015) (PubMed).
-
- CDK9 (Cyclin-Dependent Kinase 9 (CDK9))
-
Alternative Name
- CDK9
-
Background
- The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_001261, NP_001252
Target
-