Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CDKN1A cDNA Clone in Mammalian Expression Vector

This is a Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383220
Supplier Product No.: sc119947
$222.75
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CDKN1A cDNA Clone in Mammalian Expression Vector (ABIN3383220)

Gene

p21 (CDKN1A) (Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) (CDKN1A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119947

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CDKN1A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yates, Zafar, Rabai, Foxall, Nagy, Morrison, Clarke, Esiri, Christie, Smith, Nagy: "The effects of two polymorphisms on p21cip1 function and their association with Alzheimer's disease in a population of European descent." in: PLoS ONE, Vol. 10, Issue 1, pp. e0114050, (2015) (PubMed).

    Kim, Chen, Bolton: "Androgen Receptor-Mediated Growth Suppression of HPr-1AR and PC3-Lenti-AR Prostate Epithelial Cells." in: PLoS ONE, Vol. 10, Issue 9, pp. e0138286, (2015) (PubMed).

    Fournier, Coudert, Mellaoui, Adjibade, Gareau, Côté, Sonenberg, Gaudreault, Mazroui: "Inactivation of the mTORC1-eukaryotic translation initiation factor 4E pathway alters stress granule formation." in: Molecular and cellular biology, Vol. 33, Issue 11, pp. 2285-301, (2013) (PubMed).

    Gizatullin, Yao, Kung, Harding, Loda, Shapiro: "The Aurora kinase inhibitor VX-680 induces endoreduplication and apoptosis preferentially in cells with compromised p53-dependent postmitotic checkpoint function." in: Cancer research, Vol. 66, Issue 15, pp. 7668-77, (2006) (PubMed).

  • Target

    p21 (CDKN1A) (Cyclin-Dependent Kinase Inhibitor 1A (p21, Cip1) (CDKN1A))

    Alternative Name

    CDKN1A

    Background

    This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or -cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at G1. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Multiple alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) differs in the 5' UTR, lacks an in-frame portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 2. Variants 1, 2, 4 and 5 encode the same isoform 1.

    NCBI Accession

    NM_000389, NP_000380
You are here: