Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CELF1 cDNA Clone in Mammalian Expression Vector

This is a CUGBP, Elav-Like Family Member 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3780 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383232
Supplier Product No.: sc128043
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CELF1 cDNA Clone in Mammalian Expression Vector (ABIN3383232)

Gene

CELF1 (CUGBP, Elav-Like Family Member 1 (CELF1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc128043

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CELF1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3780 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Liu, Ouyang, Rao, Zou, Xiao, Chung, Wu, Donahue, Gorospe, Wang: "Competition between RNA-binding proteins CELF1 and HuR modulates MYC translation and intestinal epithelium renewal." in: Molecular biology of the cell, Vol. 26, Issue 10, pp. 1797-810, (2015) (PubMed).

    Chung, Rao, Zou, Liu, Xiao, Gu, Turner, Yang, Wang: "Jnk2 deletion disrupts intestinal mucosal homeostasis and maturation by differentially modulating RNA-binding proteins HuR and CUGBP1." in: American journal of physiology. Cell physiology, Vol. 306, Issue 12, pp. C1167-75, (2014) (PubMed).

    Yu, Rao, Zou, Liu, Xiao, Ouyang, Cao, Gorospe, Wang: "Competitive binding of CUGBP1 and HuR to occludin mRNA controls its translation and modulates epithelial barrier function." in: Molecular biology of the cell, Vol. 24, Issue 2, pp. 85-99, (2013) (PubMed).

  • Target

    CELF1 (CUGBP, Elav-Like Family Member 1 (CELF1))

    Alternative Name

    CELF1

    Background

    Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. This gene may play a role in myotonic dystrophy type 1 (DM1) via interactions with the dystrophia myotonica-protein kinase (DMPK) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) is the predominant transcript and it encodes isoform 1.

    NCBI Accession

    NM_006560, NP_006551
You are here: