Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CST3 cDNA Clone in Mammalian Expression Vector

This is a Cystatin C plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 820 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383487
Supplier Product No.: sc110862
$148.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CST3 cDNA Clone in Mammalian Expression Vector (ABIN3383487)

Gene

CST3 (Cystatin C (CST3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc110862

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CST3 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    820 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    CST3 (Cystatin C (CST3))

    Alternative Name

    CST3

    Background

    The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes the most abundant extracellular inhibitor of cysteine proteases, which is found in high concentrations in biological fluids and is expressed in virtually all organs of the body. A mutation in this gene has been associated with amyloid angiopathy. Expression of this protein in vascular wall smooth muscle cells is severely reduced in both atherosclerotic and aneurysmal aortic lesions, establishing its role in vascular disease. In addition, this protein has been shown to have an antimicrobial function, inhibiting the replication of herpes simplex virus. Alternative splicing results in multiple transcript variants encoding a single protein. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (1) differs in the 3' UTR compared to variant 2. Variants 1 and 2 encode the same protein.

    NCBI Accession

    NM_000099, NP_000090
You are here: