Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CTBP2 cDNA Clone in Mammalian Expression Vector

This is a C-terminal Binding Protein 2 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2660 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383495
Supplier Product No.: sc127174
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CTBP2 cDNA Clone in Mammalian Expression Vector (ABIN3383495)

Gene

CTBP2 (C-terminal Binding Protein 2 (CTBP2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc127174

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CTBP2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2660 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Barroilhet, Yang, Hasselblatt, Paranal, Ng, Rauh-Hain, Welch, Bradner, Berkowitz, Ng: "C-terminal binding protein-2 regulates response of epithelial ovarian cancer cells to histone deacetylase inhibitors." in: Oncogene, Vol. 32, Issue 33, pp. 3896-903, (2013) (PubMed).

  • Target

    CTBP2 (C-terminal Binding Protein 2 (CTBP2))

    Alternative Name

    CTBP2

    Background

    This gene produces alternative transcripts encoding two distinct proteins. One protein is a transcriptional repressor, while the other isoform is a major component of specialized synapses known as synaptic ribbons. Both proteins contain a NAD+ binding domain similar to NAD+-dependent 2-hydroxyacid dehydrogenases. A portion of the 3' untranslated region was used to map this gene to chromosome 21q21.3, however, it was noted that similar loci elsewhere in the genome are likely. Blast analysis shows that this gene is present on chromosome 10. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014].Transcript Variant: This variant (1) contains a distinct 5' UTR and 5' CDS, compared to variant 2. Variants 1, 3, 4, and 5 all encode the same isoform (1), which has a distinct N-terminus that is 540 aa shorter than the N-terminus of isoform 2. The protein is thought to bind to the C-terminus of the adenovirus E1A proteins. Studies in mice suggest that this protein is involved in transcriptional repression.

    NCBI Accession

    NM_001329, NP_001320
You are here: