Human CTNNB1 cDNA Clone in Mammalian Expression Vector
This is a Catenin (Cadherin-Associated Protein), beta 1, 88kDa plasmid from OriGene - 8 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(8 references)
Catalog No. ABIN3383503
Supplier Product No.: sc107921
$445.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CTNNB1 cDNA Clone in Mammalian Expression Vector (ABIN3383503)
Gene
CTNNB1
(Catenin (Cadherin-Associated Protein), beta 1, 88kDa (CTNNB1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc107921
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CTNNB1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Functional inhibition of β-catenin-mediated Wnt signaling by intracellular VHH antibodies." in: mAbs, Vol. 7, Issue 1, pp. 180-91, (2015) (PubMed).
: "Podocalyxin promotes glioblastoma multiforme cell invasion and proliferation via β-catenin signaling." in: PLoS ONE, Vol. 9, Issue 10, pp. e111343, (2014) (PubMed).
: "Altered protease-activated receptor-1 expression and signaling in a malignant pleural mesothelioma cell line, NCI-H28, with homozygous deletion of the ?-catenin gene." in: PLoS ONE, Vol. 9, Issue 11, pp. e111550, (2014) (PubMed).
: "Negative cross-talk between calcium-sensing receptor and β-catenin signaling systems in colonic epithelium." in: The Journal of biological chemistry, Vol. 287, Issue 2, pp. 1158-67, (2012) (PubMed).
: "β-Catenin activates the HOXA10 and CDX4 genes in myeloid progenitor cells." in: The Journal of biological chemistry, Vol. 287, Issue 47, pp. 39589-601, (2012) (PubMed).
: "Protein kinase C ζ is a positive modulator of canonical Wnt signaling pathway in tumoral colon cell lines." in: Carcinogenesis, Vol. 32, Issue 11, pp. 1615-24, (2011) (PubMed).
: "The imprinted gene PEG3 inhibits Wnt signaling and regulates glioma growth." in: The Journal of biological chemistry, Vol. 285, Issue 11, pp. 8472-80, (2010) (PubMed).
: "Targeting PKC: a novel role for beta-catenin in ER stress and apoptotic signaling." in: Blood, Vol. 113, Issue 7, pp. 1513-21, (2009) (PubMed).
-
-
- CTNNB1 (Catenin (Cadherin-Associated Protein), beta 1, 88kDa (CTNNB1))
-
Alternative Name
- CTNNB1
-
Background
- The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Three transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Oct 2009].Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein.
-
NCBI Accession
- NM_001904, NP_001895
Target
-
You are here:
