Human CTSB cDNA Clone in Mammalian Expression Vector
This is a Cathepsin B plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3383509
Supplier Product No.: sc109129
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CTSB cDNA Clone in Mammalian Expression Vector (ABIN3383509)
Gene
Cathepsin B (CTSB)
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc109129
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CTSB is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Cathepsin B and uPAR regulate self-renewal of glioma-initiating cells through GLI-regulated Sox2 and Bmi1 expression." in: Carcinogenesis, Vol. 34, Issue 3, pp. 550-9, (2013) (PubMed).
: "Cathepsin B and uPAR knockdown inhibits tumor-induced angiogenesis by modulating VEGF expression in glioma." in: Cancer gene therapy, Vol. 18, Issue 6, pp. 419-34, (2011) (PubMed).
: "Alpha5beta1-integrin controls ebolavirus entry by regulating endosomal cathepsins." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 106, Issue 19, pp. 8003-8, (2009) (PubMed).
-
-
- Cathepsin B (CTSB)
-
Alternative Name
- CTSB
-
Background
- This gene encodes a member of the C1 family of peptidases. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin B light and heavy chains, which can dimerize to form the double chain form of the enzyme. This enzyme is a lysosomal cysteine protease with both endopeptidase and exopeptidase activity that may play a role in protein turnover. It is also known as amyloid precursor protein secretase and is involved in the proteolytic processing of amyloid precursor protein (APP). Incomplete proteolytic processing of APP has been suggested to be a causative factor in Alzheimer's disease, the most common cause of dementia. Overexpression of the encoded protein has been associated with esophageal adenocarcinoma and other tumors. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Nov 2015].Transcript Variant: This variant (1) represents the shortest but predominant transcript. All five variants encode the same protein.
-
NCBI Accession
- NM_001908, NP_001899
Target
-
You are here:
