Human DDX3X cDNA Clone in Mammalian Expression Vector
This is a DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 3, X-Linked plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4700 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3383618
Supplier Product No.: sc119279
$915.75
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human DDX3X cDNA Clone in Mammalian Expression Vector (ABIN3383618)
Gene
DDX3X
(DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 3, X-Linked (DDX3X))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119279
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DDX3X is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4700 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
"Correction: reduced p21WAF1/CIP1 via alteration of p53-DDX3 pathway is associated with poor relapse-free survival in early-stage human papillomavirus-associated lung cancer." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 21, Issue 4, pp. 935, (2015) (PubMed).
: "DDX3 loss by p53 inactivation promotes tumor malignancy via the MDM2/Slug/E-cadherin pathway and poor patient outcome in non-small-cell lung cancer." in: Oncogene, Vol. 33, Issue 12, pp. 1515-26, (2014) (PubMed).
-
-
- DDX3X (DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 3, X-Linked (DDX3X))
-
Alternative Name
- DDX3X
-
Background
- The protein encoded by this gene is a member of the large DEAD-box protein family, that is defined by the presence of the conserved Asp-Glu-Ala-Asp (DEAD) motif, and has ATP-dependent RNA helicase activity. This protein has been reported to display a high level of RNA-independent ATPase activity, and unlike most DEAD-box helicases, the ATPase activity is thought to be stimulated by both RNA and DNA. This protein has multiple conserved domains and is thought to play roles in both the nucleus and cytoplasm. Nuclear roles include transcriptional regulation, mRNP assembly, pre-mRNA splicing, and mRNA export. In the cytoplasm, this protein is thought to be involved in translation, cellular signaling, and viral replication. Misregulation of this gene has been implicated in tumorigenesis. This gene has a paralog located in the nonrecombining region of the Y chromosome. Pseudogenes sharing similarity to both this gene and the DDX3Y paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_001356, NP_001347
Target
-
You are here:
