Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human EDNRA cDNA Clone in Mammalian Expression Vector

This is a Endothelin Receptor Type A plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4290 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383779
Supplier Product No.: sc118901
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human EDNRA cDNA Clone in Mammalian Expression Vector (ABIN3383779)

Gene

Endothelin-1 Receptor (EDNRA) (Endothelin Receptor Type A (EDNRA))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118901

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human EDNRA is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4290 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shinoda, Shinya, Ito, Ishizuka-Katsura, Ohsawa, Terada, Hirata, Kawano, Yamamoto, Tomita, Ishibashi, Hirabayashi, Kimura-Someya, Shirouzu, Yokoyama: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, pp. 30442, (2016) (PubMed).

    Gordon, Weaver, Zechi-Ceide, Madsen, Tavares, Oufadem, Kurihara, Adameyko, Picard, Breton, Pierrot, Biosse-Duplan, Voisin, Masson, Bole-Feysot, Nitschké, Delrue, Lacombe, Guion-Almeida, Moura, Garib et al.: "Mutations in the endothelin receptor type A cause mandibulofacial dysostosis with alopecia. ..." in: American journal of human genetics, Vol. 96, Issue 4, pp. 519-31, (2015) (PubMed).

    Gärtner, Seidel, Schulz, Gummert, Milting: "Desensitization and internalization of endothelin receptor A: impact of G protein-coupled receptor kinase 2 (GRK2)-mediated phosphorylation." in: The Journal of biological chemistry, Vol. 288, Issue 45, pp. 32138-48, (2013) (PubMed).

    Asundi, Reed, Arca, McCutcheon, Ferrando, Clark, Luis, Tien, Firestein, Polakis: "An antibody-drug conjugate targeting the endothelin B receptor for the treatment of melanoma." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 17, Issue 5, pp. 965-75, (2011) (PubMed).

  • Target

    Endothelin-1 Receptor (EDNRA) (Endothelin Receptor Type A (EDNRA))

    Alternative Name

    EDNRA

    Background

    This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009].Transcript Variant: This variant (1, also known as ET-AR) represents the longest transcript and encodes the longer isoform (a).

    NCBI Accession

    NM_001957, NP_001948
You are here: