Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ENO1 cDNA Clone in Mammalian Expression Vector

This is a Enolase 1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1770 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3383867
Supplier Product No.: sc119247
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ENO1 cDNA Clone in Mammalian Expression Vector (ABIN3383867)

Gene

ENO1 (Enolase 1 (ENO1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119247

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ENO1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1770 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Baleva, Gowher, Kamenski, Tarassov, Entelis, Masquida: "A Moonlighting Human Protein Is Involved in Mitochondrial Import of tRNA." in: International journal of molecular sciences, Vol. 16, Issue 5, pp. 9354-67, (2015) (PubMed).

    Ngo, Peng, Liang, Akeju, Pastorino, Zhang, Kotliarov, Zenklusen, Fine, Maric, Wen, De Girolami, Black, Wu, Shen, Jeffries, Kang, Park: "The 1p-encoded protein stathmin and resistance of malignant gliomas to nitrosoureas." in: Journal of the National Cancer Institute, Vol. 99, Issue 8, pp. 639-52, (2007) (PubMed).

  • Target

    ENO1 (Enolase 1 (ENO1))

    Alternative Name

    ENO1

    Background

    This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011].Transcript Variant: This variant (1) encodes the longer isoform (1), which is localized to the cytosol, and has alpha-enolase activity. It has been reported that the monomeric form of this isoform functions as a structural lens protein (tau-crystallin), and the dimeric form as an enolase (PMID:2462567).

    NCBI Accession

    NM_001428, NP_001419
You are here: