Human F13A1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human F13A1 cDNA Clone in Mammalian Expression Vector (ABIN3383958)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc120099
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human F13A1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3870 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- F13A1 (Coagulation Factor XIII, A1 Polypeptide (F13A1))
-
Alternative Name
- F13A1
-
Background
- This gene encodes the coagulation factor XIII A subunit. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as plasma carrier molecules. Platelet factor XIII is comprised only of 2 A subunits, which are identical to those of plasma origin. Upon cleavage of the activation peptide by thrombin and in the presence of calcium ion, the plasma factor XIII dissociates its B subunits and yields the same active enzyme, factor XIIIa, as platelet factor XIII. This enzyme acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. It also crosslinks alpha-2-plasmin inhibitor, or fibronectin, to the alpha chains of fibrin. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits, and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_000129, NP_000120
Target
-