Human FXYD5 cDNA Clone in Mammalian Expression Vector
This is a FXYD Domain Containing Ion Transport Regulator 5 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: not_set. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
Catalog No. ABIN3384140
Supplier Product No.: sc115114
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human FXYD5 cDNA Clone in Mammalian Expression Vector (ABIN3384140)
Gene
FXYD5
(FXYD Domain Containing Ion Transport Regulator 5 (FXYD5))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc115114
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human FXYD5 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- FXYD5 (FXYD Domain Containing Ion Transport Regulator 5 (FXYD5))
-
Alternative Name
- FXYD5
-
Background
- This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. This gene product, FXYD5, is a glycoprotein that functions in the up-regulation of chemokine production, and it is involved in the reduction of cell adhesion via its ability to down-regulate E-cadherin. It also promotes metastasis, and has been linked to a variety of cancers. Alternative splicing results in multiple transcript variants. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Sep 2009]. Transcript Variant: This variant (4) differs in the 5'-most exon compared to variant 1. This variant is represented as non-coding due to the presence of an upstream ORF that overlaps and is expected to inhibit translation of the longest ORF, as found in variant 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
-
NCBI Accession
- NM_014164, NP_054883
Target
-
You are here:
