Human GAPDH cDNA Clone in Mammalian Expression Vector
This is a Glyceraldehyde-3-Phosphate Dehydrogenase plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1290 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(5 references)
Catalog No. ABIN3384180
Supplier Product No.: sc118869
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human GAPDH cDNA Clone in Mammalian Expression Vector (ABIN3384180)
Gene
GAPDH
(Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc118869
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human GAPDH is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 1290 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Expression of organic anion transporter 2 in the human kidney and its potential role in the tubular secretion of guanine-containing antiviral drugs." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 40, Issue 3, pp. 617-24, (2012) (PubMed).
: "Human and pneumococcal cell surface glyceraldehyde-3-phosphate dehydrogenase (GAPDH) proteins are both ligands of human C1q protein." in: The Journal of biological chemistry, Vol. 287, Issue 51, pp. 42620-33, (2012) (PubMed).
: "Inhibition of encephalomyocarditis virus and poliovirus replication by quinacrine: implications for the design and discovery of novel antiviral drugs." in: Journal of virology, Vol. 84, Issue 18, pp. 9390-7, (2010) (PubMed).
: "Ribozyme-mediated reduction of wild-type and mutant cartilage oligomeric matrix protein (COMP) mRNA and protein." in: RNA (New York, N.Y.), Vol. 15, Issue 4, pp. 686-95, (2009) (PubMed).
: "BMP-2/4 and BMP-6/7 differentially utilize cell surface receptors to induce osteoblastic differentiation of human bone marrow-derived mesenchymal stem cells." in: The Journal of biological chemistry, Vol. 283, Issue 30, pp. 20948-58, (2008) (PubMed).
-
-
- GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH))
-
Alternative Name
- GAPDH
-
Background
- This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (1) encodes the longer isoform (1).
-
NCBI Accession
- NM_002046, NP_002037
Target
-
You are here:
