Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human H2AFY cDNA Clone in Mammalian Expression Vector

This is a H2A Histone Family, Member Y plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2100 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384362
Supplier Product No.: sc110068
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human H2AFY cDNA Clone in Mammalian Expression Vector (ABIN3384362)

Gene

H2AFY (H2A Histone Family, Member Y (H2AFY))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc110068

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human H2AFY is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2100 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yang, Yin, Zhong, Liao, Li: "Inhibition of osteosarcoma cell progression by MacroH2A via the downregulation of cyclin D and cyclin‑dependent kinase genes." in: Molecular medicine reports, Vol. 11, Issue 3, pp. 1905-10, (2014) (PubMed).

  • Target

    H2AFY (H2A Histone Family, Member Y (H2AFY))

    Alternative Name

    H2AFY

    Background

    Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015].Transcript Variant: This variant (2) has a unique 5' UTR and uses an alternate splice site in its coding region, compared to variant 3. This results in a protein (isoform 2) that is a single amino acid shorter than isoform 3. Variants 2 and 4 encode the same isoform (2).

    NCBI Accession

    NM_004893, NP_004884
You are here: