Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HDAC1 cDNA Clone in Mammalian Expression Vector

This is a Histone Deacetylase 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2200 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384386
Supplier Product No.: sc117054
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human HDAC1 cDNA Clone in Mammalian Expression Vector (ABIN3384386)

Gene

HDAC1 (Histone Deacetylase 1 (HDAC1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc117054

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HDAC1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2200 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Incani, Serra, Meloni, Cossu, Saba, Cabras, Messana, Rosatelli: "AIRE acetylation and deacetylation: effect on protein stability and transactivation activity." in: Journal of biomedical science, Vol. 21, pp. 85, (2014) (PubMed).

    Vogelauer, Krall, McBrian, Li, Kurdistani: "Stimulation of histone deacetylase activity by metabolites of intermediary metabolism." in: The Journal of biological chemistry, Vol. 287, Issue 38, pp. 32006-16, (2012) (PubMed).

    Hong, Derfoul, Pereira-Mouries, Hall: "A novel domain in histone deacetylase 1 and 2 mediates repression of cartilage-specific genes in human chondrocytes." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 23, Issue 10, pp. 3539-52, (2009) (PubMed).

    Poleshko, Palagin, Zhang, Boimel, Castagna, Adams, Skalka, Katz: "Identification of cellular proteins that maintain retroviral epigenetic silencing: evidence for an antiviral response." in: Journal of virology, Vol. 82, Issue 5, pp. 2313-23, (2008) (PubMed).

  • Target

    HDAC1 (Histone Deacetylase 1 (HDAC1))

    Alternative Name

    HDAC1

    Background

    Histone acetylation and deacetylation, catalyzed by multisubunit complexes, play a key role in the regulation of eukaryotic gene expression. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family and is a component of the histone deacetylase complex. It also interacts with retinoblastoma tumor-suppressor protein and this complex is a key element in the control of cell proliferation and differentiation. Together with metastasis-associated protein-2, it deacetylates p53 and modulates its effect on cell growth and apoptosis. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_004964, NP_004955
You are here: