Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HIF1A cDNA Clone in Mammalian Expression Vector

This is a Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384409
Supplier Product No.: sc119189
$1,124.64
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human HIF1A cDNA Clone in Mammalian Expression Vector (ABIN3384409)

Gene

HIF1A (Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) (HIF1A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc119189

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HIF1A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Wei, Zhou, Qiao, Ni, Li, You, Guo, Lu: "Oroxylin A inhibits glycolysis-dependent proliferation of human breast cancer via promoting SIRT3-mediated SOD2 transcription and HIF1α destabilization." in: Cell death & disease, Vol. 6, pp. e1714, (2015) (PubMed).

    Snell, Turley, McIntyre, Li, Masiero, Schofield, Gatter, Harris, Pezzella: "Proline-hydroxylated hypoxia-inducible factor 1α (HIF-1α) upregulation in human tumours." in: PLoS ONE, Vol. 9, Issue 2, pp. e88955, (2014) (PubMed).

    Bhaskara, Mohanam, Gujrati, Mohanam: "Intermittent hypoxia effect on osteoclastogenesis stimulated by neuroblastoma cells." in: PLoS ONE, Vol. 9, Issue 8, pp. e105555, (2014) (PubMed).

    Liu, Wang, Wu, Tan, Wen, Wang, Zhu, Wang, Li, Ma, Pan: "Variations of CITED2 are associated with congenital heart disease (CHD) in Chinese population." in: PLoS ONE, Vol. 9, Issue 5, pp. e98157, (2014) (PubMed).

    Md Hashim, Nicholas, Dart, Kiriakidis, Paleolog, Wells: "Hypoxia-induced invadopodia formation: a role for β-PIX." in: Open biology, Vol. 3, Issue 6, pp. 120159, (2013) (PubMed).

    Filiano, Bailey, Tucholski, Gundemir, Johnson: "Transglutaminase 2 protects against ischemic insult, interacts with HIF1beta, and attenuates HIF1 signaling." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 22, Issue 8, pp. 2662-75, (2008) (PubMed).

  • Target

    HIF1A (Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) (HIF1A))

    Alternative Name

    HIF1A

    Background

    This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1.

    NCBI Accession

    NM_001530, NP_001521
You are here: