Human HIF1A cDNA Clone in Mammalian Expression Vector
This is a Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4000 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(6 references)
Catalog No. ABIN3384409
Supplier Product No.: sc119189
$1,124.64
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human HIF1A cDNA Clone in Mammalian Expression Vector (ABIN3384409)
Gene
HIF1A
(Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) (HIF1A))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc119189
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HIF1A is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 4000 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Oroxylin A inhibits glycolysis-dependent proliferation of human breast cancer via promoting SIRT3-mediated SOD2 transcription and HIF1α destabilization." in: Cell death & disease, Vol. 6, pp. e1714, (2015) (PubMed).
: "Proline-hydroxylated hypoxia-inducible factor 1α (HIF-1α) upregulation in human tumours." in: PLoS ONE, Vol. 9, Issue 2, pp. e88955, (2014) (PubMed).
: "Intermittent hypoxia effect on osteoclastogenesis stimulated by neuroblastoma cells." in: PLoS ONE, Vol. 9, Issue 8, pp. e105555, (2014) (PubMed).
: "Variations of CITED2 are associated with congenital heart disease (CHD) in Chinese population." in: PLoS ONE, Vol. 9, Issue 5, pp. e98157, (2014) (PubMed).
: "Hypoxia-induced invadopodia formation: a role for β-PIX." in: Open biology, Vol. 3, Issue 6, pp. 120159, (2013) (PubMed).
: "Transglutaminase 2 protects against ischemic insult, interacts with HIF1beta, and attenuates HIF1 signaling." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 22, Issue 8, pp. 2662-75, (2008) (PubMed).
-
: "Oroxylin A inhibits glycolysis-dependent proliferation of human breast cancer via promoting SIRT3-mediated SOD2 transcription and HIF1α destabilization." in: Cell death & disease, Vol. 6, pp. e1714, (2015) (PubMed).
-
- HIF1A (Hypoxia Inducible Factor 1, alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) (HIF1A))
-
Alternative Name
- HIF1A
-
Background
- This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1.
-
NCBI Accession
- NM_001530, NP_001521
Target
-
You are here:
