Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human HNRNPA1 cDNA Clone in Mammalian Expression Vector

This is a Heterogeneous Nuclear Ribonucleoprotein A1 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1840 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384470
Supplier Product No.: sc109308
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human HNRNPA1 cDNA Clone in Mammalian Expression Vector (ABIN3384470)

Gene

HNRNPA1 (Heterogeneous Nuclear Ribonucleoprotein A1 (HNRNPA1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc109308

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human HNRNPA1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1840 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Redon, Zemp, Lingner: "A three-state model for the regulation of telomerase by TERRA and hnRNPA1." in: Nucleic acids research, Vol. 41, Issue 19, pp. 9117-28, (2013) (PubMed).

    Chatel-Chaix, Melançon, Racine, Baril, Lamarre: "Y-box-binding protein 1 interacts with hepatitis C virus NS3/4A and influences the equilibrium between viral RNA replication and infectious particle production." in: Journal of virology, Vol. 85, Issue 21, pp. 11022-37, (2011) (PubMed).

  • Target

    HNRNPA1 (Heterogeneous Nuclear Ribonucleoprotein A1 (HNRNPA1))

    Alternative Name

    HNRNPA1

    Background

    This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (1) lacks an alternate in-frame exon in the coding region, compared to variant 2, resulting in a shorter protein (isoform 1) that lacks an internal segment, compared to isoform 2. This variant is the predominant transcript.

    NCBI Accession

    NM_002136, NP_002127
You are here: