Human HNRNPK cDNA Clone in Mammalian Expression Vector
This is a Heterogeneous Nuclear Ribonucleoprotein K plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2840 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3384485
Supplier Product No.: sc107869
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human HNRNPK cDNA Clone in Mammalian Expression Vector (ABIN3384485)
Gene
HNRNPK
(Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc107869
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HNRNPK is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2840 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The importance of heterogeneous nuclear ribonucleoprotein K on cytochrome P450 2D2 gene regulation: its binding is reduced in Dark Agouti rats." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 37, Issue 8, pp. 1703-10, (2009) (PubMed).
-
: "The importance of heterogeneous nuclear ribonucleoprotein K on cytochrome P450 2D2 gene regulation: its binding is reduced in Dark Agouti rats." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 37, Issue 8, pp. 1703-10, (2009) (PubMed).
-
- HNRNPK (Heterogeneous Nuclear Ribonucleoprotein K (HNRNPK))
-
Alternative Name
- HNRNPK
-
Background
- This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene is located in the nucleoplasm and has three repeats of KH domains that binds to RNAs. It is distinct among other hnRNP proteins in its binding preference, it binds tenaciously to poly(C). This protein is also thought to have a role during cell cycle progession. Several alternatively spliced transcript variants have been described for this gene, however, not all of them are fully characterized. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3) uses an alternate acceptor splice site at the last coding exon compared to transcript variant 1. This results in a frame-shift and an isoform (b) with a distinct C-terminus compared to isoform a.
-
NCBI Accession
- NM_031262, NP_112552
Target
-
You are here:
