Human HSPA8 cDNA Clone in Mammalian Expression Vector
This is a Heat Shock 70kDa Protein 8 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2190 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3384544
Supplier Product No.: sc115973
$595.98
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human HSPA8 cDNA Clone in Mammalian Expression Vector (ABIN3384544)
Gene
Hsc70 (HSPA8)
(Heat Shock 70kDa Protein 8 (HSPA8))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc115973
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human HSPA8 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2190 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Hsc70 facilitates TGF-β-induced activation of Smad2/3 in fibroblastic NRK-49F cells." in: Biochemical and biophysical research communications, Vol. 477, Issue 3, pp. 448-53, (2016) (PubMed).
: "The active Hsc70/tau complex can be exploited to enhance tau turnover without damaging microtubule dynamics." in: Human molecular genetics, Vol. 24, Issue 14, pp. 3971-81, (2015) (PubMed).
: "Isoform-selective Genetic Inhibition of Constitutive Cytosolic Hsp70 Activity Promotes Client Tau Degradation Using an Altered Co-chaperone Complement." in: The Journal of biological chemistry, Vol. 290, Issue 21, pp. 13115-27, (2015) (PubMed).
: "C-Mannosylated peptides derived from the thrombospondin type 1 repeat interact with Hsc70 to modulate its signaling in RAW264.7 cells." in: Glycobiology, Vol. 20, Issue 10, pp. 1298-310, (2010) (PubMed).
-
: "Hsc70 facilitates TGF-β-induced activation of Smad2/3 in fibroblastic NRK-49F cells." in: Biochemical and biophysical research communications, Vol. 477, Issue 3, pp. 448-53, (2016) (PubMed).
-
- Hsc70 (HSPA8) (Heat Shock 70kDa Protein 8 (HSPA8))
-
Alternative Name
- HSPA8
-
Background
- This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011].Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1).
-
NCBI Accession
- NM_006597, NP_006588
Target
-
You are here:
