Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human IDH1 cDNA Clone in Mammalian Expression Vector

This is a Isocitrate Dehydrogenase 1 (NADP+), Soluble plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2210 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384563
Supplier Product No.: sc116430
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human IDH1 cDNA Clone in Mammalian Expression Vector (ABIN3384563)

Gene

IDH1 (Isocitrate Dehydrogenase 1 (NADP+), Soluble (IDH1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116430

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human IDH1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2210 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Gross, Cairns, Minden, Driggers, Bittinger, Jang, Sasaki, Jin, Schenkein, Su, Dang, Fantin, Mak: "Cancer-associated metabolite 2-hydroxyglutarate accumulates in acute myelogenous leukemia with isocitrate dehydrogenase 1 and 2 mutations." in: The Journal of experimental medicine, Vol. 207, Issue 2, pp. 339-44, (2010) (PubMed).

    Yan, Parsons, Jin, McLendon, Rasheed, Yuan, Kos, Batinic-Haberle, Jones, Riggins, Friedman, Friedman, Reardon, Herndon, Kinzler, Velculescu, Vogelstein, Bigner: "IDH1 and IDH2 mutations in gliomas." in: The New England journal of medicine, Vol. 360, Issue 8, pp. 765-73, (2009) (PubMed).

    Dang, White, Gross, Bennett, Bittinger, Driggers, Fantin, Jang, Jin, Keenan, Marks, Prins, Ward, Yen, Liau, Rabinowitz, Cantley, Thompson, Vander Heiden, Su: "Cancer-associated IDH1 mutations produce 2-hydroxyglutarate." in: Nature, Vol. 462, Issue 7274, pp. 739-44, (2009) (PubMed).

  • Target

    IDH1 (Isocitrate Dehydrogenase 1 (NADP+), Soluble (IDH1))

    Alternative Name

    IDH1

    Background

    Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013].Transcript Variant: This variant (1) and variants 2 and 3 encode the same protein.

    NCBI Accession

    NM_005896, NP_005887
You are here: