Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human IRF1 cDNA Clone in Mammalian Expression Vector

This is a Interferon Regulatory Factor 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384654
Supplier Product No.: sc118744
$445.50
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human IRF1 cDNA Clone in Mammalian Expression Vector (ABIN3384654)

Gene

IRF1 (Interferon Regulatory Factor 1 (IRF1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118744

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human IRF1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Larrea, Riezu-Boj, Aldabe, Guembe, Echeverria, Balasiddaiah, Gastaminza, Civeira, Sarobe, Prieto: "Dysregulation of interferon regulatory factors impairs the expression of immunostimulatory molecules in hepatitis C virus genotype 1-infected hepatocytes." in: Gut, Vol. 63, Issue 4, pp. 665-73, (2014) (PubMed).

    Zhang, Leir, Harris: "Immune mediators regulate CFTR expression through a bifunctional airway-selective enhancer." in: Molecular and cellular biology, Vol. 33, Issue 15, pp. 2843-53, (2013) (PubMed).

    Bego, Mercier, Cohen: "Virus-activated interferon regulatory factor 7 upregulates expression of the interferon-regulated BST2 gene independently of interferon signaling." in: Journal of virology, Vol. 86, Issue 7, pp. 3513-27, (2012) (PubMed).

    Sun, Alkhoury, Wang, Foster, Radecke, Tam, Edwards, Facciotti, Armstrong, Knowlton, Newman, Passerini, Simon: "IRF-1 and miRNA126 modulate VCAM-1 expression in response to a high-fat meal." in: Circulation research, Vol. 111, Issue 8, pp. 1054-64, (2012) (PubMed).

  • Target

    IRF1 (Interferon Regulatory Factor 1 (IRF1))

    Alternative Name

    IRF1

    Background

    IRF1 encodes interferon regulatory factor 1, a member of the interferon regulatory transcription factor (IRF) family. IRF1 serves as an activator of interferons alpha and beta transcription, and in mouse it has been shown to be required for double-stranded RNA induction of these genes. IRF1 also functions as a transcription activator of genes induced by interferons alpha, beta, and gamma. Further, IRF1 has been shown to play roles in regulating apoptosis and tumor-suppressoion. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_002198, NP_002189
You are here: