Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human ITGB1 cDNA Clone in Mammalian Expression Vector

This is a Integrin beta 1 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3800 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384669
Supplier Product No.: sc111935
$1,206.70
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human ITGB1 cDNA Clone in Mammalian Expression Vector (ABIN3384669)

Gene

ITGB1 (Integrin beta 1 (ITGB1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc111935

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human ITGB1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3800 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Yang, Hou, Zhou, Wen, Zhou, Xu, Tang, Du, Hu, Liu: "Twist induces epithelial-mesenchymal transition and cell motility in breast cancer via ITGB1-FAK/ILK signaling axis and its associated downstream network." in: The international journal of biochemistry & cell biology, Vol. 71, pp. 62-71, (2016) (PubMed).

    Lee, Oh, Lee, Lee, Ko, Kim, Kim, Kim, Song, Kim, Kim, Han: "Gln-362 of angiopoietin-2 mediates migration of tumor and endothelial cells through association with α5β1 integrin." in: The Journal of biological chemistry, Vol. 289, Issue 45, pp. 31330-40, (2014) (PubMed).

    Steinberg, Heesom, Bass, Cullen: "SNX17 protects integrins from degradation by sorting between lysosomal and recycling pathways." in: The Journal of cell biology, Vol. 197, Issue 2, pp. 219-30, (2012) (PubMed).

  • Target

    ITGB1 (Integrin beta 1 (ITGB1))

    Alternative Name

    ITGB1

    Background

    Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1A) represents the longest transcript and encodes the shorter isoform (1A). Both variants 1A and 1E encode the same isoform.

    NCBI Accession

    NM_002211, NP_002202
You are here: