Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human KCND2 cDNA Clone in Mammalian Expression Vector

This is a Potassium Voltage-Gated Channel, Shal-Related Subfamily, Member 2 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384709
Supplier Product No.: sc115436
$581.13
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human KCND2 cDNA Clone in Mammalian Expression Vector (ABIN3384709)

Gene

KCND2 (Potassium Voltage-Gated Channel, Shal-Related Subfamily, Member 2 (KCND2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115436

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human KCND2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Anderson, Mehaffey, Iftinca, Rehak, Engbers, Hameed, Zamponi, Turner: "Regulation of neuronal activity by Cav3-Kv4 channel signaling complexes." in: Nature neuroscience, Vol. 13, Issue 3, pp. 333-7, (2010) (PubMed).

    Hasdemir, Fitzgerald, Prior, Tepikin, Burgoyne: "Traffic of Kv4 K+ channels mediated by KChIP1 is via a novel post-ER vesicular pathway." in: The Journal of cell biology, Vol. 171, Issue 3, pp. 459-69, (2005) (PubMed).

    Fujii, Numata, Nakamura, Honda, Furukawa, Urano, Wiels, Uchikawa, Ozaki, Matsuo, Sugiura, Furukawa: "Murine glycosyltransferases responsible for the expression of globo-series glycolipids: cDNA structures, mRNA expression, and distribution of their products." in: Glycobiology, Vol. 15, Issue 12, pp. 1257-67, (2005) (PubMed).

  • Target

    KCND2 (Potassium Voltage-Gated Channel, Shal-Related Subfamily, Member 2 (KCND2))

    Alternative Name

    KCND2

    Background

    Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_012281, NP_036413
You are here: