Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human LOXL2 cDNA Clone in Mammalian Expression Vector

This is a Lysyl Oxidase-Like 2 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3550 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3384902
Supplier Product No.: sc118675
$1,053.36
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human LOXL2 cDNA Clone in Mammalian Expression Vector (ABIN3384902)

Gene

LOXL2 (Lysyl Oxidase-Like 2 (LOXL2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118675

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human LOXL2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3550 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • de Jong, van Balkom, Gremmels, Verhaar: "Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2." in: Journal of cellular and molecular medicine, Vol. 20, Issue 2, pp. 342-50, (2016) (PubMed).

    Wong, Tse, Huang, Zhu, Chiu, Lai, Au, Kai, Lee, Wei, Tsang, Lo, Shi, Zheng, Wong, Ng: "Lysyl oxidase-like 2 is critical to tumor microenvironment and metastatic niche formation in hepatocellular carcinoma." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1645-58, (2014) (PubMed).

    Xu, Go, Finney, Moon, Lantz, Rebecchi, Desaire, Mure: "Post-translational modifications of recombinant human lysyl oxidase-like 2 (rhLOXL2) secreted from Drosophila S2 cells." in: The Journal of biological chemistry, Vol. 288, Issue 8, pp. 5357-63, (2013) (PubMed).

    Bignon, Pichol-Thievend, Hardouin, Malbouyres, Bréchot, Nasciutti, Barret, Teillon, Guillon, Etienne, Caron, Joubert-Caron, Monnot, Ruggiero, Muller, Germain: "Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane." in: Blood, Vol. 118, Issue 14, pp. 3979-89, (2011) (PubMed).

  • Target

    LOXL2 (Lysyl Oxidase-Like 2 (LOXL2))

    Alternative Name

    LOXL2

    Background

    This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_002318, NP_002309
You are here: