Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MDH1 cDNA Clone in Mammalian Expression Vector

This is a Malate Dehydrogenase 1, NAD (Soluble) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1370 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385064
Supplier Product No.: sc116447
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MDH1 cDNA Clone in Mammalian Expression Vector (ABIN3385064)

Gene

MDH1 (Malate Dehydrogenase 1, NAD (Soluble) (MDH1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116447

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MDH1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1370 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Stiebler, Freitag, Schink, Stehlik, Tillmann, Ast, Bölker: "Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals." in: PLoS genetics, Vol. 10, Issue 10, pp. e1004685, (2014) (PubMed).

  • Target

    MDH1 (Malate Dehydrogenase 1, NAD (Soluble) (MDH1))

    Alternative Name

    MDH1

    Background

    This gene encodes an enzyme that catalyzes the NAD/NADH-dependent, reversible oxidation of malate to oxaloacetate in many metabolic pathways, including the citric acid cycle. Two main isozymes are known to exist in eukaryotic cells: one is found in the mitochondrial matrix and the other in the cytoplasm. This gene encodes the cytosolic isozyme, which plays a key role in the malate-aspartate shuttle that allows malate to pass through the mitochondrial membrane to be transformed into oxaloacetate for further cellular processes. Alternatively spliced transcript variants have been found for this gene. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes X and 6. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (2) has an alternate 5' exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1.

    NCBI Accession

    NM_005917, NP_005908
You are here: