Human MMP9 cDNA Clone in Mammalian Expression Vector
This is a Matrix Metallopeptidase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa Type IV Collagenase) plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2500 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(5 references)
Catalog No. ABIN3385169
Supplier Product No.: sc116989
$962.28
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human MMP9 cDNA Clone in Mammalian Expression Vector (ABIN3385169)
Gene
MMP 9 (MMP9)
(Matrix Metallopeptidase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa Type IV Collagenase) (MMP9))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc116989
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MMP9 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2500 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Diverse matrix metalloproteinase functions regulate cancer amoeboid migration." in: Nature communications, Vol. 5, pp. 4255, (2014) (PubMed).
: "The transcription factor SPDEF suppresses prostate tumor metastasis." in: The Journal of biological chemistry, Vol. 287, Issue 35, pp. 29968-78, (2012) (PubMed).
: "siRNA-mediated downregulation of MMP-9 and uPAR in combination with radiation induces G2/M cell-cycle arrest in Medulloblastoma." in: Molecular cancer research : MCR, Vol. 9, Issue 1, pp. 51-66, (2011) (PubMed).
: "Ectopic matrix metalloproteinase-9 expression in human brain tumor cells enhances oncolytic HSV vector infection." in: Gene therapy, Vol. 17, Issue 10, pp. 1200-5, (2010) (PubMed).
: "The hemopexin domain of matrix metalloproteinase-9 activates cell signaling and promotes migration of schwann cells by binding to low-density lipoprotein receptor-related protein." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 28, Issue 45, pp. 11571-82, (2008) (PubMed).
-
-
- MMP 9 (MMP9) (Matrix Metallopeptidase 9 (Gelatinase B, 92kDa Gelatinase, 92kDa Type IV Collagenase) (MMP9))
-
Alternative Name
- MMP9
-
Background
- Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_004994, NP_004985
Target
-
You are here:
