Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MRPS18A cDNA Clone in Mammalian Expression Vector

This is a Mitochondrial Ribosomal Protein S18A plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1080 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385241
Supplier Product No.: sc113696
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MRPS18A cDNA Clone in Mammalian Expression Vector (ABIN3385241)

Gene

MRPS18A (Mitochondrial Ribosomal Protein S18A (MRPS18A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc113696

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MRPS18A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1080 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kim, Abedi, Liu, Panuganti, Flores, Shah, Catterall, Morampudi, Terbrueggen: "A novel technology for multiplex gene expression analysis directly from whole blood samples stabilized at ambient temperature using an RNA-stabilizing buffer." in: The Journal of molecular diagnostics : JMD, Vol. 17, Issue 2, pp. 118-27, (2015) (PubMed).

  • Target

    MRPS18A (Mitochondrial Ribosomal Protein S18A (MRPS18A))

    Alternative Name

    MRPS18A

    Background

    Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75 % protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S18P family. The encoded protein is one of three that has significant sequence similarity to bacterial S18 proteins. The primary sequences of the three human mitochondrial S18 proteins are no more closely related to each other than they are to the prokaryotic S18 proteins. A pseudogene corresponding to this gene is found on chromosome 3p. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).

    NCBI Accession

    NM_018135, NP_060605
You are here: