Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human MSH6 cDNA Clone in Mammalian Expression Vector

This is a MutS Homolog 6 (E. Coli) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4310 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385258
Supplier Product No.: sc120035
$1,728.54
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human MSH6 cDNA Clone in Mammalian Expression Vector (ABIN3385258)

Gene

MSH6 (MutS Homolog 6 (E. Coli) (MSH6))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc120035

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human MSH6 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4310 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Shahi, Lee, Kang, Lee, Hyun, Chang, Jun, You: "Mismatch-repair protein MSH6 is associated with Ku70 and regulates DNA double-strand break repair." in: Nucleic acids research, Vol. 39, Issue 6, pp. 2130-43, (2011) (PubMed).

    Valeri, Gasparini, Fabbri, Braconi, Veronese, Lovat, Adair, Vannini, Fanini, Bottoni, Costinean, Sandhu, Nuovo, Alder, Gafa, Calore, Ferracin, Lanza, Volinia, Negrini, McIlhatton, Amadori, Fishel et al.: "Modulation of mismatch repair and genomic stability by miR-155. ..." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 15, pp. 6982-7, (2010) (PubMed).

  • Target

    MSH6 (MutS Homolog 6 (E. Coli) (MSH6))

    Alternative Name

    MSH6

    Background

    This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1).

    NCBI Accession

    NM_000179, NP_000170
You are here: