Human NFE2L2 cDNA Clone in Mammalian Expression Vector
This is a Nuclear Factor (erythroid-Derived 2)-Like 2 plasmid from OriGene - 9 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2600 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(9 references)
Catalog No. ABIN3385424
Supplier Product No.: sc116283
$558.36
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human NFE2L2 cDNA Clone in Mammalian Expression Vector (ABIN3385424)
Gene
NRF2 (NFE2L2)
(Nuclear Factor (erythroid-Derived 2)-Like 2 (NFE2L2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc116283
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NFE2L2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Acidosis induces reprogramming of cellular metabolism to mitigate oxidative stress." in: Cancer & metabolism, Vol. 1, Issue 1, pp. 23, (2014) (PubMed).
: "Nrf1 and Nrf2 transcription factors regulate androgen receptor transactivation in prostate cancer cells." in: PLoS ONE, Vol. 9, Issue 1, pp. e87204, (2014) (PubMed).
: "Impaired activation of the Nrf2-ARE signaling pathway undermines H2O2-induced oxidative stress response: a possible mechanism for melanocyte degeneration in vitiligo." in: The Journal of investigative dermatology, Vol. 134, Issue 8, pp. 2221-30, (2014) (PubMed).
: "An oxidative stress mechanism of shikonin in human glioma cells." in: PLoS ONE, Vol. 9, Issue 4, pp. e94180, (2014) (PubMed).
: "Nrf2 is associated with the regulation of basal transcription activity of the BRCA1 gene." in: Acta biochimica et biophysica Sinica, Vol. 45, Issue 3, pp. 179-87, (2013) (PubMed).
: "Recombinant adenovirus Ad-RUNrf2 reduces paraquat-induced A549 injury." in: Human & experimental toxicology, Vol. 31, Issue 11, pp. 1102-12, (2012) (PubMed).
: "Heme oxygenase-1 protects human melanocytes from H2O2-induced oxidative stress via the Nrf2-ARE pathway." in: The Journal of investigative dermatology, Vol. 131, Issue 7, pp. 1420-7, (2011) (PubMed).
: "CYP2C9*1B promoter polymorphisms, in linkage with CYP2C19*2, affect phenytoin autoinduction of clearance and maintenance dose." in: The Journal of pharmacology and experimental therapeutics, Vol. 332, Issue 2, pp. 599-611, (2010) (PubMed).
: "Overcoming resistance to histone deacetylase inhibitors in human leukemia with the redox modulating compound β-phenylethyl isothiocyanate." in: Blood, Vol. 116, Issue 15, pp. 2732-41, (2010) (PubMed).
-
-
- NRF2 (NFE2L2) (Nuclear Factor (erythroid-Derived 2)-Like 2 (NFE2L2))
-
Alternative Name
- NFE2L2
-
Background
- This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters, many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. Multiple transcript variants encoding different isoforms have been characterized for this gene. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_006164, NP_006155
Target
-
You are here:
