Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NFE2L2 cDNA Clone in Mammalian Expression Vector

This is a Nuclear Factor (erythroid-Derived 2)-Like 2 plasmid from OriGene - 9 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385424
Supplier Product No.: sc116283
$558.36
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NFE2L2 cDNA Clone in Mammalian Expression Vector (ABIN3385424)

Gene

NRF2 (NFE2L2) (Nuclear Factor (erythroid-Derived 2)-Like 2 (NFE2L2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc116283

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NFE2L2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Lamonte, Tang, Chen, Wu, Ding, Keenan, Sangokoya, Kung, Ilkayeva, Boros, Newgard, Chi: "Acidosis induces reprogramming of cellular metabolism to mitigate oxidative stress." in: Cancer & metabolism, Vol. 1, Issue 1, pp. 23, (2014) (PubMed).

    Schultz, Hagan, Datta, Zhang, Freeman, Sikka, Abdel-Mageed, Mondal: "Nrf1 and Nrf2 transcription factors regulate androgen receptor transactivation in prostate cancer cells." in: PLoS ONE, Vol. 9, Issue 1, pp. e87204, (2014) (PubMed).

    Jian, Li, Song, Zhu, Zhu, Cui, Liu, Tang, Wang, Wang, Gao, Li: "Impaired activation of the Nrf2-ARE signaling pathway undermines H2O2-induced oxidative stress response: a possible mechanism for melanocyte degeneration in vitiligo." in: The Journal of investigative dermatology, Vol. 134, Issue 8, pp. 2221-30, (2014) (PubMed).

    Yang, Li, Wu, Lu, Chen: "An oxidative stress mechanism of shikonin in human glioma cells." in: PLoS ONE, Vol. 9, Issue 4, pp. e94180, (2014) (PubMed).

    Wang, Li, Yang, Sun, Gao, Zhu, Wu, Jin: "Nrf2 is associated with the regulation of basal transcription activity of the BRCA1 gene." in: Acta biochimica et biophysica Sinica, Vol. 45, Issue 3, pp. 179-87, (2013) (PubMed).

    Cai, Lu, Hong, Jiang, Wu, Zheng, Song, Chang: "Recombinant adenovirus Ad-RUNrf2 reduces paraquat-induced A549 injury." in: Human & experimental toxicology, Vol. 31, Issue 11, pp. 1102-12, (2012) (PubMed).

    Jian, Li, Liu, Zhang, Zhou, Li, Gao: "Heme oxygenase-1 protects human melanocytes from H2O2-induced oxidative stress via the Nrf2-ARE pathway." in: The Journal of investigative dermatology, Vol. 131, Issue 7, pp. 1420-7, (2011) (PubMed).

    Chaudhry, Urban, Lamba, Birnbaum, Remmel, Subramanian, Strom, You, Kasperaviciute, Catarino, Radtke, Sisodiya, Goldstein, Schuetz: "CYP2C9*1B promoter polymorphisms, in linkage with CYP2C19*2, affect phenytoin autoinduction of clearance and maintenance dose." in: The Journal of pharmacology and experimental therapeutics, Vol. 332, Issue 2, pp. 599-611, (2010) (PubMed).

    Hu, Lu, Chen, Zhang, Jia, Wei, Yang, Zhang, Fiskus, Bhalla, Keating, Huang, Garcia-Manero: "Overcoming resistance to histone deacetylase inhibitors in human leukemia with the redox modulating compound β-phenylethyl isothiocyanate." in: Blood, Vol. 116, Issue 15, pp. 2732-41, (2010) (PubMed).

  • Target

    NRF2 (NFE2L2) (Nuclear Factor (erythroid-Derived 2)-Like 2 (NFE2L2))

    Alternative Name

    NFE2L2

    Background

    This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters, many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. Multiple transcript variants encoding different isoforms have been characterized for this gene. [provided by RefSeq, Sep 2015].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_006164, NP_006155
You are here: