Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NFYA cDNA Clone in Mammalian Expression Vector

This is a Nuclear Transcription Factor Y, alpha plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3570 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385438
Supplier Product No.: sc112917
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NFYA cDNA Clone in Mammalian Expression Vector (ABIN3385438)

Gene

NFYA (Nuclear Transcription Factor Y, alpha (NFYA))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc112917

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NFYA is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    3570 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Morachis, Murawsky, Emerson: "Regulation of the p53 transcriptional response by structurally diverse core promoters." in: Genes & development, Vol. 24, Issue 2, pp. 135-47, (2010) (PubMed).

    Chia, Leung, Krushel, Alajez, Lo, Busson, Klamut, Bastianutto, Liu: "Nuclear factor-Y and Epstein Barr virus in nasopharyngeal cancer." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 4, pp. 984-94, (2008) (PubMed).

  • Target

    NFYA (Nuclear Transcription Factor Y, alpha (NFYA))

    Alternative Name

    NFYA

    Background

    The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) is missing alternate exon B, resulting in the short isoform, isoform 2.

    NCBI Accession

    NM_021705, NP_068351
You are here: