Human NR3C1 cDNA Clone in Mammalian Expression Vector
This is a Nuclear Receptor Subfamily 3, Group C, Member 1 (Glucocorticoid Receptor) plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 3700 bp. Transient expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3385508
Supplier Product No.: sc120032
$1,057.32
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human NR3C1 cDNA Clone in Mammalian Expression Vector (ABIN3385508)
Gene
Glucocorticoid Receptor (NR3C1)
(Nuclear Receptor Subfamily 3, Group C, Member 1 (Glucocorticoid Receptor) (NR3C1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-XL5
Promoter
Enhanced CMV Promoter, T7 Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient
-
-
Species
- Human
-
Supplier Product No.
- sc120032
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human NR3C1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3700 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Deciphering the regulatory logic of an ancient, ultraconserved nuclear receptor enhancer module." in: Molecular endocrinology (Baltimore, Md.), Vol. 29, Issue 6, pp. 856-72, (2015) (PubMed).
: "Differential interactions of antiretroviral agents with LXR, ER and GR nuclear receptors: potential contributing factors to adverse events." in: British journal of pharmacology, Vol. 171, Issue 2, pp. 480-97, (2013) (PubMed).
-
-
- Glucocorticoid Receptor (NR3C1) (Nuclear Receptor Subfamily 3, Group C, Member 1 (Glucocorticoid Receptor) (NR3C1))
-
Alternative Name
- NR3C1
-
Background
- This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011].Transcript Variant: This variant (1) represents the predominant transcript, and encodes the predominant physiological isoform (alpha, also known as GRalpha or GR-A). Variants 1-5 encode the same isoform.
-
NCBI Accession
- NM_000176, NP_000167
Target
-
You are here:
