Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human NRXN1 cDNA Clone in Mammalian Expression Vector

This is a Neurexin 1 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2400 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385524
Supplier Product No.: sc120579
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human NRXN1 cDNA Clone in Mammalian Expression Vector (ABIN3385524)

Gene

Neurexin 1 (NRXN1)

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc120579

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human NRXN1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2400 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Tanaka, Fujii, Hirano: "Live-cell imaging of receptors around postsynaptic membranes." in: Nature protocols, Vol. 9, Issue 1, pp. 76-89, (2013) (PubMed).

  • Target

    Neurexin 1 (NRXN1)

    Alternative Name

    NRXN1

    Background

    This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are cell-surface receptors that bind neuroligins to form Ca(2+)-dependent neurexin/neuroligin complexes at synapses in the central nervous system. This complex is required for efficient neurotransmission, and is involved in the formation of synaptic contacts. Three members of this gene family have been studied in detail and are estimated to generate over 3,000 variants through the use of two alternative promoters (alpha and beta) and extensive alternative splicing in each family member. Recently, a third promoter (gamma) was identified for this gene in the 3' region. The RefSeq project has decided to create only a few representative transcript variants of the multitude that are possible. Mutations in this gene are associated with Pitt-Hopkins-like syndrome-2. [provided by RefSeq, Feb 2016].Transcript Variant: This variant (beta) represents a beta neurexin transcript. It is transcribed from a downstream promoter, includes a different segment for its 5' UTR and 5' coding region, and lacks most of the 5' exons present in alpha transcripts, as compared to variant alpha2. The resulting protein (isoform beta) has a shorter and distinct N-terminus when it is compared to isoform alpha2.

    NCBI Accession

    NM_138735, NP_620072
You are here: