Human OLR1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human OLR1 cDNA Clone in Mammalian Expression Vector (ABIN3385597)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc118589
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human OLR1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: NotI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2600 bp
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "High-Density Lipoprotein Prevents Endoplasmic Reticulum Stress-Induced Downregulation of Liver LOX-1 Expression." in: PLoS ONE, Vol. 10, Issue 4, pp. e0124285, (2015) (PubMed).
: "Prevention of export of anoxia/reoxygenation injury from ischemic to nonischemic cardiomyocytes via inhibition of endocytosis." in: American journal of physiology. Heart and circulatory physiology, Vol. 306, Issue 12, pp. H1700-7, (2014) (PubMed).
: "CRP is a novel ligand for the oxidized LDL receptor LOX-1." in: American journal of physiology. Heart and circulatory physiology, Vol. 296, Issue 5, pp. H1643-50, (2009) (PubMed).
: "LOX-1-dependent transcriptional regulation in response to oxidized LDL treatment of human aortic endothelial cells." in: American journal of physiology. Cell physiology, Vol. 296, Issue 6, pp. C1329-37, (2009) (PubMed).
-
-
- OLR1 (Oxidized Low Density Lipoprotein (Lectin-Like) Receptor 1 (OLR1))
-
Alternative Name
- OLR1
-
Background
- This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_002543, NP_002534
Target
-