Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human OLR1 cDNA Clone in Mammalian Expression Vector

This is a Oxidized Low Density Lipoprotein (Lectin-Like) Receptor 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2600 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385597
Supplier Product No.: sc118589
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human OLR1 cDNA Clone in Mammalian Expression Vector (ABIN3385597)

Gene

OLR1 (Oxidized Low Density Lipoprotein (Lectin-Like) Receptor 1 (OLR1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118589

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human OLR1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2600 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Hong, Li, Gao, Wang, Li, Luo, Bai, Zhang: "High-Density Lipoprotein Prevents Endoplasmic Reticulum Stress-Induced Downregulation of Liver LOX-1 Expression." in: PLoS ONE, Vol. 10, Issue 4, pp. e0124285, (2015) (PubMed).

    Khaidakov, Mercanti, Wang, Ding, Dai, Romeo, Sawamura, Mehta: "Prevention of export of anoxia/reoxygenation injury from ischemic to nonischemic cardiomyocytes via inhibition of endocytosis." in: American journal of physiology. Heart and circulatory physiology, Vol. 306, Issue 12, pp. H1700-7, (2014) (PubMed).

    Shih, Zhang, Cao, Hahn, Wang, Paulsen, Harnish: "CRP is a novel ligand for the oxidized LDL receptor LOX-1." in: American journal of physiology. Heart and circulatory physiology, Vol. 296, Issue 5, pp. H1643-50, (2009) (PubMed).

    Mattaliano, Huard, Cao, Hill, Zhong, Martinez, Harnish, Paulsen, Shih: "LOX-1-dependent transcriptional regulation in response to oxidized LDL treatment of human aortic endothelial cells." in: American journal of physiology. Cell physiology, Vol. 296, Issue 6, pp. C1329-37, (2009) (PubMed).

  • Target

    OLR1 (Oxidized Low Density Lipoprotein (Lectin-Like) Receptor 1 (OLR1))

    Alternative Name

    OLR1

    Background

    This gene encodes a low density lipoprotein receptor that belongs to the C-type lectin superfamily. This gene is regulated through the cyclic AMP signaling pathway. The encoded protein binds, internalizes and degrades oxidized low-density lipoprotein. This protein may be involved in the regulation of Fas-induced apoptosis. This protein may play a role as a scavenger receptor. Mutations of this gene have been associated with atherosclerosis, risk of myocardial infarction, and may modify the risk of Alzheimer's disease. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_002543, NP_002534
You are here: