Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PARK7 cDNA Clone in Mammalian Expression Vector

This is a Parkinson Protein 7 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 1000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385676
Supplier Product No.: sc115623
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PARK7 cDNA Clone in Mammalian Expression Vector (ABIN3385676)

Gene

PARK7/DJ1 (PARK7) (Parkinson Protein 7 (PARK7))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc115623

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PARK7 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • He, Zheng, Li, Ben, Liu, Zhang, Ji, Yu, Chen, Su, Zhou, Liu, Yuan: "DJ-1 promotes invasion and metastasis of pancreatic cancer cells by activating SRC/ERK/uPA." in: Carcinogenesis, Vol. 33, Issue 3, pp. 555-62, (2012) (PubMed).

    Vives-Bauza, Zhou, Huang, Cui, de Vries, Kim, May, Tocilescu, Liu, Ko, Magrané, Moore, Dawson, Grailhe, Dawson, Li, Tieu, Przedborski: "PINK1-dependent recruitment of Parkin to mitochondria in mitophagy." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 1, pp. 378-83, (2010) (PubMed).

    Ngo, Peng, Liang, Akeju, Pastorino, Zhang, Kotliarov, Zenklusen, Fine, Maric, Wen, De Girolami, Black, Wu, Shen, Jeffries, Kang, Park: "The 1p-encoded protein stathmin and resistance of malignant gliomas to nitrosoureas." in: Journal of the National Cancer Institute, Vol. 99, Issue 8, pp. 639-52, (2007) (PubMed).

  • Target

    PARK7/DJ1 (PARK7) (Parkinson Protein 7 (PARK7))

    Alternative Name

    PARK7

    Background

    The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

    NCBI Accession

    NM_007262, NP_009193
You are here: