Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PINK1 cDNA Clone in Mammalian Expression Vector

This is a PTEN Induced Putative Kinase 1 plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 2710 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3385829
Supplier Product No.: sc108012
$803.88
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PINK1 cDNA Clone in Mammalian Expression Vector (ABIN3385829)

Gene

PINK1 (PTEN Induced Putative Kinase 1 (PINK1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc108012

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PINK1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2710 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Aerts, Craessaerts, De Strooper, Morais: "In Vitro Comparison of the Activity Requirements and Substrate Specificity of Human and Triboleum castaneum PINK1 Orthologues." in: PLoS ONE, Vol. 11, Issue 1, pp. e0146083, (2016) (PubMed).

    Aerts, Craessaerts, De Strooper, Morais: "PINK1 kinase catalytic activity is regulated by phosphorylation on serines 228 and 402." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2798-811, (2015) (PubMed).

    Gómez-Sánchez, Gegg, Bravo-San Pedro, Niso-Santano, Alvarez-Erviti, Pizarro-Estrella, Gutiérrez-Martín, Alvarez-Barrientos, Fuentes, González-Polo, Schapira: "Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression." in: Neurobiology of disease, Vol. 62, pp. 426-40, (2013) (PubMed).

    Zhou, Huang, Shao, May, Prou, Perier, Dauer, Schon, Przedborski: "The kinase domain of mitochondrial PINK1 faces the cytoplasm." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 33, pp. 12022-7, (2008) (PubMed).

    Sim, Lio, Mok, Masters, Hill, Culvenor, Cheng: "C-terminal truncation and Parkinson's disease-associated mutations down-regulate the protein serine/threonine kinase activity of PTEN-induced kinase-1." in: Human molecular genetics, Vol. 15, Issue 21, pp. 3251-62, (2006) (PubMed).

    Petit, Kawarai, Paitel, Sanjo, Maj, Scheid, Chen, Gu, Hasegawa, Salehi-Rad, Wang, Rogaeva, Fraser, Robinson, St George-Hyslop, Tandon: "Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations." in: The Journal of biological chemistry, Vol. 280, Issue 40, pp. 34025-32, (2005) (PubMed).

  • Target

    PINK1 (PTEN Induced Putative Kinase 1 (PINK1))

    Alternative Name

    PINK1

    Background

    This gene encodes a serine/threonine protein kinase that localizes to mitochondria. It is thought to protect cells from stress-induced mitochondrial dysfunction. Mutations in this gene cause one form of autosomal recessive early-onset Parkinson disease. [provided by RefSeq, Jul 2008].

    NCBI Accession

    NM_032409, NP_115785
You are here: