Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PRKAR1A cDNA Clone in Mammalian Expression Vector

This is a Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-XL5. Insert length: 4000 bp. Transient expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3386039
Supplier Product No.: sc118451
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PRKAR1A cDNA Clone in Mammalian Expression Vector (ABIN3386039)

Gene

PRKAR1A (Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) (PRKAR1A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-XL5

Promoter

Enhanced CMV Promoter, T7 Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient
  • Species

    Human

    Supplier Product No.

    sc118451

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PRKAR1A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: NotI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    4000 bp

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PRKAR1A (Protein Kinase, CAMP-Dependent, Regulatory, Type I, alpha (Tissue Specific Extinguisher 1) (PRKAR1A))

    Alternative Name

    PRKAR1A

    Background

    CAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013].Transcript Variant: This variant (1) contains an alternate exon in place of the first 5' UTR exon compared to variant 2. Variants 1, 2, 3, 4, and 6 all encode the same isoform (a).

    NCBI Accession

    NM_002734, NP_002725
You are here: